![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sly-MIR399 |
|||||
Accession | MI0009979 (change log) | ||||
Description | Solanum lycopersicum miR399 stem-loop | ||||
Gene family | MIPF0000015; MIR399 | ||||
Literature search |
![]()
16 open access papers mention sly-MIR399 | ||||
Stem-loop |
u a a -g a ug uca 5' uagggc ac cucu uuggcau ca cu a a |||||| || |||| ||||||| || || | 3' aucccg ug gagg aaccgua gu ga u a u a a aa c gu uau |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sly-miR399 |
|
Accession | MIMAT0009146 |
Sequence |
51 - ugccaaaggagaguugcccua - 71 |
Evidence | by similarity; MI0007960 |
References |
|
1 |
PMID:18602455
"Identification of conserved microRNAs and their targets from Solanum lycopersicum Mill"
Gene. 423:1-7(2008).
|