miRBase entry: hsa-mir-1972-1

Stem-loop hsa-mir-1972-1


Accession
MI0009982
Symbol
HGNC: MIR1972-1
Description
Homo sapiens hsa-mir-1972-1 precursor miRNA mir-1972
Gene
family?
RF04167; mir-1972

Literature search
9 open access papers mention hsa-mir-1972-1
(14 sentences)

Sequence

88 reads, 9 reads per million, 33 experiments
uauaggcaugugccaccacaccuggcuuaaaugugucauuuaaaaauUCAGGCCAGGCACAGUGGCUCAugccugua
((((((((((.(((((....((((((((.(((.............))).))))))))....))))).))))))))))

Structure
          u     caca        a   guguc 
uauaggcaug gccac    ccuggcuu aau     a
|||||||||| |||||    |||||||| |||     u
auguccguAC CGGUG    GGACCGGA Uua     u
          U     ACAC        C   aaaau 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr16: 15010321-15010397 [-]

Disease association
hsa-mir-1972-1 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-1972

Accession MIMAT0009447
Description Homo sapiens hsa-miR-1972 mature miRNA
Sequence 48 - UCAGGCCAGGCACAGUGGCUCA - 69
Evidence experimental
cloned [1]
Database links
Predicted targets

References

  1. PubMed ID: 18923441
    Identification of new microRNA genes and aberrant microRNA profiles in childhood acute lymphoblastic leukemia
    "Schotte D, Chau JC, Sylvester G, Liu G, Chen C, van der Velden VH, Broekhuis MJ, Peters TC, Pieters R, den Boer ML"
    "Leukemia (2009) 23:313-322