![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-1983 |
|||||
Accession | MI0009990 (change log) | ||||
Symbol | MGI:Mir1983 | ||||
Description | Mus musculus miR-1983 stem-loop | ||||
Literature search |
![]()
8 open access papers mention mmu-mir-1983 | ||||
Stem-loop |
---ccuuuaca ---u -------- -- uag g g u a 5' gagaaagcaugcuccag ggc gcaa ucggu cgc c guac uauac g ||||||||||||||||| ||| |||| ||||| ||| | |||| ||||| 3' uucuuuuguacgagguc ccg uguu agccg gug g cgug auaug c ccgccuuuccc cacu agcuugag gg -ua - g u a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
Babiarz et al. show that mir-1983 is derived from Dicer-dependent processing of an alternative hairpin conformation of a tRNA(Ile) sequence [1]. The biological significance of the mature miRNA is unknown, and tRNA-derived miRNA sequences are not expected to be prevalent. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence mmu-miR-1983 |
|
Accession | MIMAT0009455 |
Sequence |
100 - cucaccuggagcauguuuucu - 120 |
Deep sequencing | 24216 reads, 101 experiments |
Evidence | experimental; Illumina [1] |
Database links |
|
Predicted targets |
|
References |
|
1 |
PMID:18923076
"Mouse ES cells express endogenous shRNAs, siRNAs, and other Microprocessor-independent, Dicer-dependent small RNAs"
Genes Dev. 22:2773-2785(2008).
|