Stem-loop sequence cfa-mir-299

AccessionMI0010384 (change log)
DescriptionCanis familiaris miR-299 stem-loop
Gene family MIPF0000186; mir-299
Stem-loop
        a                      uu 
5' aagaa ugguuuaccgucccacauacau  u
   ||||| ||||||||||||||||||||||  g
3' uucuu gccaaauggcaggguguaugua  a
        c                      ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69255548-69255610 [+]
antisense
ENSCAFT00000032611 ; cfa-mir-299-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-299
cfa-mir-379chr8: 69253808-69253866 [+]
cfa-mir-411chr8: 69255094-69255151 [+]
cfa-mir-299chr8: 69255548-69255610 [+]
cfa-mir-380chr8: 69256764-69256820 [+]
cfa-mir-323chr8: 69257494-69257549 [+]
cfa-mir-758chr8: 69257782-69257862 [+]
cfa-mir-329bchr8: 69258528-69258607 [+]
cfa-mir-329achr8: 69258855-69258914 [+]
cfa-mir-494chr8: 69261385-69261465 [+]
cfa-mir-543chr8: 69263406-69263463 [+]
cfa-mir-495chr8: 69265169-69265226 [+]
Database links

Mature sequence cfa-miR-299

Accession MIMAT0009885
Sequence

7 - 

ugguuuaccgucccacauacau

 - 28

Get sequence
Evidence by similarity; MI0000399
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).