Stem-loop sequence cfa-mir-329b

AccessionMI0010398 (change log)
DescriptionCanis familiaris miR-329b stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
        cu           uu ug   uuc      u  aa 
5' gguac  gaagagagguu  c  ggu   uguuuc uu  u
   |||||  |||||||||||  |  |||   |||||| ||   
3' cuaug  cuuuucuccaa  g  cca   acaaag ag  g
        ac           uu gu   --c      u  ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69258528-69258607 [+]
sense
ENSCAFT00000039967 ; cfa-mir-329b-201; exon 1
Clustered miRNAs
< 10kb from cfa-mir-329b
cfa-mir-379chr8: 69253808-69253866 [+]
cfa-mir-411chr8: 69255094-69255151 [+]
cfa-mir-299chr8: 69255548-69255610 [+]
cfa-mir-380chr8: 69256764-69256820 [+]
cfa-mir-323chr8: 69257494-69257549 [+]
cfa-mir-758chr8: 69257782-69257862 [+]
cfa-mir-329bchr8: 69258528-69258607 [+]
cfa-mir-329achr8: 69258855-69258914 [+]
cfa-mir-494chr8: 69261385-69261465 [+]
cfa-mir-543chr8: 69263406-69263463 [+]
cfa-mir-495chr8: 69265169-69265226 [+]
cfa-mir-3958chr8: 69267134-69267274 [+]
Database links

Mature sequence cfa-miR-329b

Accession MIMAT0009899
Sequence

50 - 

aacacaccugguuaaccucuuu

 - 71

Get sequence
Evidence not experimental
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).