Stem-loop sequence cfa-mir-487a

AccessionMI0010401 (change log)
DescriptionCanis familiaris miR-487a stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
         u     g   uua      c    -    cu  a 
5' gguacu gaaga ugg   ucccug ugug uucg  gu u
   |||||| ||||| |||   |||||| |||| ||||  ||  
3' cuauga uuuuu acc   agggac auac aagc  ua u
         c     g   uac      -    u    ag  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69281078-69281157 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-487a
cfa-mir-376a-1chr8: 69271259-69271316 [+]
cfa-mir-300chr8: 69271815-69271892 [+]
cfa-mir-1185chr8: 69273204-69273332 [+]
cfa-mir-381chr8: 69274983-69275057 [+]
cfa-mir-487bchr8: 69275496-69275553 [+]
cfa-mir-539chr8: 69276311-69276386 [+]
cfa-mir-889chr8: 69276842-69276980 [+]
cfa-mir-544chr8: 69277656-69277744 [+]
cfa-mir-487achr8: 69281078-69281157 [+]
cfa-mir-382chr8: 69283123-69283179 [+]
cfa-mir-134chr8: 69283496-69283568 [+]
cfa-mir-485chr8: 69284239-69284297 [+]
cfa-mir-496chr8: 69289410-69289507 [+]
cfa-mir-377chr8: 69290937-69291005 [+]
Database links

Mature sequence cfa-miR-487a

Accession MIMAT0009902
Sequence

49 - 

aaucauacagggacauccagu

 - 69

Get sequence
Evidence by similarity; MI0005022
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).