Stem-loop sequence cfa-mir-494

AccessionMI0010404 (change log)
DescriptionCanis familiaris miR-494 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
         c            gu      -   c   -  uuu 
5' gauacu gaaggagagguu  ccgugu ugu uuc uc   a
   |||||| ||||||||||||  |||||| ||| ||| ||   u
3' cuauga uuuuuucuccaa  ggcaca aca aag ag   u
         -            ag      u   -   u  uau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CanFam3.1; GCA_000002285.2) Overlapping transcripts
chr8: 69261385-69261465 [+]
intergenic
Clustered miRNAs
< 10kb from cfa-mir-494
cfa-mir-379chr8: 69253808-69253866 [+]
cfa-mir-411chr8: 69255094-69255151 [+]
cfa-mir-299chr8: 69255548-69255610 [+]
cfa-mir-380chr8: 69256764-69256820 [+]
cfa-mir-323chr8: 69257494-69257549 [+]
cfa-mir-758chr8: 69257782-69257862 [+]
cfa-mir-329bchr8: 69258528-69258607 [+]
cfa-mir-329achr8: 69258855-69258914 [+]
cfa-mir-494chr8: 69261385-69261465 [+]
cfa-mir-543chr8: 69263406-69263463 [+]
cfa-mir-495chr8: 69265169-69265226 [+]
cfa-mir-3958chr8: 69267134-69267274 [+]
cfa-mir-376a-3chr8: 69269752-69269810 [+]
cfa-mir-376cchr8: 69270100-69270185 [+]
cfa-mir-376a-2chr8: 69270499-69270556 [+]
cfa-mir-376bchr8: 69270858-69270956 [+]
cfa-mir-376a-1chr8: 69271259-69271316 [+]
Database links

Mature sequence cfa-miR-494

Accession MIMAT0009905
Sequence

48 - 

ugaaacauacacgggaaaccuc

 - 69

Get sequence
Evidence by similarity; MI0003134
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).