Stem-loop sequence sma-mir-125b

AccessionMI0010677 (change log)
DescriptionSchistosoma mansoni miR-125b stem-loop
Gene family MIPF0000033; mir-10
Literature search

4 open access papers mention sma-mir-125b
(13 sentences)

Stem-loop
   -auc       c              uuu    u   aa 
5'     ccugaga ugauaauugcucuu   auca gau  g
       ||||||| ||||||||||||||   |||| |||   
3'     ggacucu auuauuaacgagag   uagu uug  g
   augu       c              ---    -   ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WTSI5) Overlapping transcripts
Chr_1.unplaced.SC_0071: 1248571-1248645 [+]
intergenic
Database links

Mature sequence sma-miR-125b

Accession MIMAT0010184
Sequence

2 - 

ucccugagacugauaauugcuc

 - 23

Get sequence
Evidence by similarity; MI0010672

References

1
PMID:19107204 "Identification and characterization of novel microRNAs from Schistosoma japonicum" Xue X, Sun J, Zhang Q, Wang Z, Huang Y, Pan W PLoS One. 3:e4034(2008).