Stem-loop sequence gga-mir-2127

AccessionMI0010732 (change log)
DescriptionGallus gallus miR-2127 stem-loop
Literature search

1 open access papers mention gga-mir-2127
(1 sentences)

Stem-loop
             ccgg       -  g          uug   g         a  a 
5' ccuccuuguc    cucgucc cc cuuccucccu   ucu cggccgccg ac g
   ||||||||||    ||||||| || ||||||||||   ||| ||||||||| || g
3' ggagggacgg    gagcggg gg gagggagggg   agg gccggcggu ug c
             ---a       c  -          ---   -         g  c 
Get sequence
Deep sequencing
19 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 165879963-165880066 [+]
sense
ENSGALT00000027401 ; NAA16-201; intron 1
Database links

Mature sequence gga-miR-2127

Accession MIMAT0011203
Sequence

69 - 

cgggaggggagggagggcggg

 - 89

Get sequence
Deep sequencing16 reads, 5 experiments
Evidence experimental; Illumina [1], Northern [1]
Predicted targets

References

1
PMID:19328789 "High throughput sequencing of microRNAs in chicken somites" Rathjen T, Pais H, Sweetman D, Moulton V, Munsterberg A, Dalmay T FEBS Lett. 583:1422-1426(2009).