![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence sbi-MIR160f |
|||||
Accession | MI0010864 (change log) | ||||
Description | Sorghum bicolor miR160f stem-loop | ||||
Gene family | MIPF0000032; MIR160 | ||||
Literature search |
![]()
3 open access papers mention sbi-MIR160f | ||||
Stem-loop |
------------------------ c g u a aa a cg 5' ugc uggcucccu aaugcca ccg gag gca ugccau u ||| ||||||||| ||||||| ||| ||| ||| |||||| g 3' acg acugaggga uugcggu ggc cuc cgu gcggua u cgacgacuccguuacguucguugg u g u c -- - cc |
||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence sbi-miR160f |
|
Accession | MIMAT0011324 |
Sequence |
1 - ugccuggcucccugaaugcca - 21 |
Evidence | by similarity; MI0001101 |
References |
|
1 |
PMID:19189423
"The Sorghum bicolor genome and the diversification of grasses"
Nature. 457:551-556(2009).
|