Stem-loop sequence osa-MIR2118e

AccessionMI0011255 (change log)
DescriptionOryza sativa miR2118e stem-loop
Gene family MIPF0000745; MIR2118
Literature search

29 open access papers mention osa-MIR2118e
(164 sentences)

Stem-loop 
      g  u       a     aaaa   a          a c          -a   g a      aac         uuuc   -c      a 
5' agu ag caggaag ggaag    gag gucuaagagc g aggcauggga  cau g ggaaaa   auauauagu    uuc  ccucua a
   ||| || ||||||| |||||    ||| |||||||||| | ||||||||||  ||| | ||||||   |||||||||    |||  ||||||  
3' ucg uu guccuuc ccuuc    cuc cggauucuug c uccguacccu  gua c ccuuuu   ugugugucg    aag  ggagau g
      g  -       a     ----   a          a a          cc   a -      ---         uuua   uu      u
Get sequence
Deep sequencing
128 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MSU7) Overlapping transcripts
Chr4: 21647428-21647604 [-]
intergenic
Clustered miRNAs
< 10kb from osa-MIR2118e
osa-MIR2118kChr4: 21656944-21657120 [-]
osa-MIR2118lChr4: 21656708-21656884 [-]
osa-MIR2118jChr4: 21654594-21654764 [-]
osa-MIR2118hChr4: 21652652-21652808 [-]
osa-MIR2118iChr4: 21652388-21652568 [-]
osa-MIR2118fChr4: 21650514-21650682 [-]
osa-MIR5522Chr4: 21650324-21650436 [+]
osa-MIR2118gChr4: 21650301-21650460 [-]
osa-MIR2118cChr4: 21647968-21648064 [-]
osa-MIR2118dChr4: 21647689-21647864 [-]
osa-MIR2118eChr4: 21647428-21647604 [-]
osa-MIR2118bChr4: 21645285-21645463 [-]
osa-MIR1869Chr4: 21644852-21644989 [+]
osa-MIR2118aChr4: 21642923-21643101 [-]
Database links

Mature sequence osa-miR2118e

Accession MIMAT0011744
Sequence

121 -  

uucccaaugccucccaugccua

 - 142

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19584097 "Clusters and superclusters of phased small RNAs in the developing inflorescence of rice" Johnson C, Kasprzewska A, Tennessen K, Fernandes J, Nan GL, Walbot V, Sundaresan V, Vance V, Bowman LH Genome Res. 19:1429-1440(2009).