![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence zma-MIR2118a |
|||||
Accession | MI0011271 (change log) | ||||
Description | Zea mays miR2118a stem-loop | ||||
Gene family | MIPF0000745; MIR2118 | ||||
Literature search |
![]()
11 open access papers mention zma-MIR2118a | ||||
Stem-loop |
a -a ga -- u ugaa u c 5' ccuaagggc guagggaugaga cau aggaacgcga gugc c uuuc cgu u ||||||||| |||||||||||| ||| |||||||||| |||| | |||| ||| c 3' ggauucuug uauccuuacucu gua uccuugugcu cacg g ggag gca g g cc -g gu u uaca - c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
|
Mature sequence zma-miR2118a |
|
Accession | MIMAT0011760 |
Sequence |
86 - uuccugaugccucucauuccua - 107 |
Deep sequencing | 8 reads, 4 experiments |
Evidence | experimental; 454 [1] |
References |
|
1 |
PMID:19584097
"Clusters and superclusters of phased small RNAs in the developing inflorescence of rice"
Genome Res. 19:1429-1440(2009).
|