Stem-loop sequence bta-mir-2378

AccessionMI0011413 (change log)
DescriptionBos taurus miR-2378 stem-loop
Stem-loop
   u    a    u uu aug u       --     -uu   a 
5'  ggga ggag g  c   g cucaggc  uccac   agc g
    |||| |||| |  |   | |||||||  |||||   |||  
3'  cccu ccuu u  g   c gagucug  gggug   ucg a
   a    -    c gg -aa -       uu     ucu   g 
Get sequence
Deep sequencing
7 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr23: 28284050-28284127 [-]
sense
ENSBTAT00000009098 ; ABCF1-201; intron 14
Clustered miRNAs
< 10kb from bta-mir-2378
bta-mir-877chr23: 28284423-28284524 [-]
bta-mir-2378chr23: 28284050-28284127 [-]
Database links

Mature sequence bta-miR-2378

Accession MIMAT0011924
Sequence

47 - 

uguggguugucugagcaaggg

 - 67

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:19633723 "Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection" Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ PLoS One. 4:e6349(2009).