Stem-loop sequence bdi-MIR171a

AccessionMI0011559 (change log)
DescriptionBrachypodium distachyon miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

1 open access papers mention bdi-MIR171a
(3 sentences)

Stem-loop
   gagguaggaggcggagcggaggaaaggcuucccgaccgggg        ug   ga  ---     caau 
5'                                          gaagcugg  auu  gc   cgcgc    a
                                            ||||||||  |||  ||   |||||    u
3'                                          cuucggcc  uaa  ug   gcgcg    c
   --------------------cgacgccgccgcuuucgucga        gu   gg  acc     cucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 52059037-52059156 [-]
intergenic
Database links

Mature sequence bdi-miR171a

Accession MIMAT0012174
Sequence

50 - 

ugauugagccgcgccaauauc

 - 70

Get sequence
Evidence experimental; qRT-PCR [1]

References

1