Stem-loop sequence bdi-MIR167a

AccessionMI0011561 (change log)
Previous IDsbdi-MIR167
DescriptionBrachypodium distachyon miR167a stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

2 open access papers mention bdi-MIR167a
(8 sentences)

Stem-loop
   -------------------------a   aaa  -   aa   -    g  ug -  u 
5'                           gag   gc gug  gcu gcca ca  a uc a
                             |||   || |||  ||| |||| ||  | || u
3'                           cuu   cg cac  uga cggu gu  u ag c
   cggccggggcuucggugccgcaacga   aaa  a   cg   a    g  gu c  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 6349045-6349135 [+]
intergenic
Database links

Mature sequence bdi-miR167a

Accession MIMAT0012176
Previous IDsbdi-miR167
Sequence

11 - 

ugaagcugccagcaugaucua

 - 31

Get sequence
Evidence experimental; qRT-PCR [1]

References

1
2
PMID:21371551 "Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs" Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G Genomics. 97:282-293(2011).