Stem-loop sequence bdi-MIR1139

AccessionMI0011562 (change log)
DescriptionBrachypodium distachyon miR1139 stem-loop
Gene family MIPF0000810; MIR1139
Literature search

1 open access papers mention bdi-MIR1139
(2 sentences)

Stem-loop
   -------------------------------------------------------------------------------u    -    ----     uau 
5'                                                                                 ccuc ugau    uggac   u
                                                                                   |||| ||||    |||||    
3'                                                                                 ggag acua    gcuug   a
   uauuuacucugaauauacaaugaugaaauuauauacguacaaugaucacauacaaugagcggugacacuggucggaguuc    c    ucac     uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 53829174-53829293 [+]
intergenic
Database links

Mature sequence bdi-miR1139

Accession MIMAT0012177
Sequence

62 - 

gaguaacauacacuaguaaca

 - 82

Get sequence
Evidence by similarity; MI0006201

References

1