Stem-loop sequence bdi-MIR437

AccessionMI0011573 (change log)
DescriptionBrachypodium distachyon miR437 stem-loop
Gene family MIPF0000746; MIR437
Literature search

1 open access papers mention bdi-MIR437
(2 sentences)

Stem-loop
   uaaagacaauaugaauacauauauuucauuauggauaaaaugaaacuaauuuggugucauaagucuug     ---------       aaaagauu          a 
5'                                                                     guaua         uuugucu        ggucgaacuu g
                                                                       |||||         |||||||        ||||||||||  
3'                                                                     caugu         aaacaga        ucaguuugaa a
   --------------------------------------------------------------cucccu     uguaaauac       ------au          g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 67022612-67022752 [-]
intergenic
Database links

Mature sequence bdi-miR437

Accession MIMAT0012188
Sequence

93 - 

gaacuuagagaaguuugacuu

 - 113

Get sequence
Evidence by similarity; MI0001688

References

1