Stem-loop sequence bdi-MIR1127

AccessionMI0011575 (change log)
DescriptionBrachypodium distachyon miR1127 stem-loop
Gene family MIPF0000382; MIR1122
Literature search

1 open access papers mention bdi-MIR1127
(1 sentences)

Stem-loop
   uccaccgggacaaguuaguuaacuacucccuccgucc   a      ggcau    -u   --        aaac   u 
5'                                      gau uuaagu     ucua  uac  auguaucu    guu u
                                        ||| ||||||     ||||  |||  ||||||||    ||| u
3'                                      cug aguuca     aggu  aug  uacauaga    caa u
   ----------------------------------uca   -      --aac    uu   cu        ----   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 58113848-58113964 [+]
intergenic
Database links

Mature sequence bdi-miR1127

Accession MIMAT0012190
Sequence

21 - 

aacuacucccuccguccgaua

 - 41

Get sequence
Evidence by similarity; MI0006189

References

1