![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence bmo-mir-989a |
|||||||
Accession | MI0012205 (change log) | ||||||
Previous IDs | bmo-mir-989 | ||||||
Description | Bombyx mori miR-989 stem-loop | ||||||
Gene family | MIPF0000885; mir-989 | ||||||
Literature search |
3 open access papers mention bmo-mir-989a | ||||||
Stem-loop |
g g a gg c -gu g - au 5' guucagg uuga au ccauuac ucaca cacgu gu c g ||||||| |||| || ||||||| ||||| ||||| || | 3' uaggucc agcu ug ggugaug agugu gugca ca g a a - c aa c agu a u gu |
||||||
Deep sequencing |
| ||||||
Confidence |
Annotation confidence: not enough data
| ||||||
Genome context |
|
||||||
Database links |
|
Mature sequence bmo-miR-989a |
|
Accession | MIMAT0012633 |
Previous IDs | bmo-miR-989 |
Sequence |
56 - gugugaugugacguaguggaa - 76 |
Deep sequencing | 309 reads, 3 experiments |
Evidence | experimental; cloned [1], Illumina [2], RTPCR [3] |
Database links |
|
References |
|
1 |
PMID:19699294
"A discovery of novel microRNAs in the silkworm (Bombyx mori) genome"
Genomics. 94:438-444(2009).
|
2 |
PMID:20199675
"MicroRNAs of Bombyx mori identified by Solexa sequencing"
BMC Genomics. 11:148(2010).
|
3 |
PMID:19823945
"Computational identification and characteristics of novel microRNAs from the silkworm (Bombyx mori L.)"
Mol Biol Rep. 37:3171-3176(2010).
|