Stem-loop sequence bmo-mir-989a

Accession

MI0012205 (change log)

Previous IDs

bmo-mir-989

Description

Bombyx mori miR-989 stem-loop

Gene family

MIPF0000885; mir-989

Literature search

3 open access papers mention bmo-mir-989a
(4 sentences)

Stem-loop

   g       g    a  gg       c     -gu     g  - au 
5'  guucagg uuga au  ccauuac ucaca   cacgu gu c  g
    ||||||| |||| ||  ||||||| |||||   ||||| || |   
3'  uaggucc agcu ug  ggugaug agugu   gugca ca g  a
   a       -    c  aa       c     agu     a  u gu 

Deep sequencing

309 reads, 0 reads per million, 3 experiments

Confidence

Annotation confidence: not enough data

Feedback: Do you believe this miRNA is real?

Genome context

Coordinates (ASM15162v1; GCA_000151625.1)	Overlapping transcripts
NW_004582008.1: 14748776-14748866 [-]	intergenic
NW_004622344.1: 425-515 [+]	intergenic

Database links

• miRBase Tracker:MI0012205

Mature sequence bmo-miR-989a

• Accession: MIMAT0012633
• Previous IDs: bmo-miR-989
• Sequence: 56 - gugugaugugacguaguggaa - 76
• Deep sequencing: 309 reads, 3 experiments
• Evidence: experimental; cloned [1], Illumina [2], RTPCR [3]
• Database links:
  • RNAcentral:URS000045781D_7091

References

1. PMID:19699294 "A discovery of novel microRNAs in the silkworm (Bombyx mori) genome" Yu X, Zhou Q, Cai Y, Luo Q, Lin H, Hu S, Yu J Genomics. 94:438-444(2009).
2. PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).
3. PMID:19823945 "Computational identification and characteristics of novel microRNAs from the silkworm (Bombyx mori L.)" Huang Y, Zou Q, Tang SM, Wang LG, Shen XJ Mol Biol Rep. 37:3171-3176(2010).