Stem-loop sequence bmo-mir-2772b

AccessionMI0012327 (change log)
DescriptionBombyx mori miR-2772b stem-loop
Gene family MIPF0000906; mir-2772
Literature search

1 open access papers mention bmo-mir-2772b
(1 sentences)

Stem-loop
   uucuu   -   -auc    -        -gu   ----     ca   ugg 
5'      ugc cuu    ucua aacucaaa   ggu    accag  gug   a
        ||| |||    |||| ||||||||   |||    |||||  |||    
3'      aug gag    aggu uugaguuu   ccg    ugguc  uac   u
   ggugu   c   gucu    c        gug   uugc     --   ugg 
Get sequence
Deep sequencing
3088 reads, 400 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581808.1: 173498-173593 [-]
intergenic
Clustered miRNAs
< 10kb from bmo-mir-2772b
bmo-mir-2772bNW_004581808.1: 173498-173593 [-]
bmo-mir-3326NW_004581808.1: 172351-172456 [+]
Database links

Mature sequence bmo-miR-2772b

Accession MIMAT0013653
Sequence

66 - 

uguuugaguucuggaucugga

 - 86

Get sequence
Deep sequencing3068 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).