Stem-loop sequence bmo-mir-2774b-1

AccessionMI0012335 (change log)
DescriptionBombyx mori miR-2774b-1 stem-loop
Gene family MIPF0000829; mir-2774
Literature search

1 open access papers mention bmo-mir-2774b-1
(2 sentences)

Stem-loop
   gaaca  a   ccc   cc   gg          aaua 
5'      ac aca   gga  guc  ucuaccgagc    u
        || |||   |||  |||  ||||||||||     
3'      ug ugu   ccu  uag  agauggcucg    c
   auaua  c   uuc   uc   -a          ccca 
Get sequence
Deep sequencing
415 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582019.1: 6081627-6081703 [-]
intergenic
Database links

Mature sequence bmo-miR-2774b

Accession MIMAT0013661
Sequence

46 - 

cucgguagaagaucuucccuuu

 - 67

Get sequence
Deep sequencing442 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).