Stem-loop sequence bmo-mir-2774a-4

AccessionMI0012337 (change log)
DescriptionBombyx mori miR-2774a-4 stem-loop
Gene family MIPF0000829; mir-2774
Literature search

1 open access papers mention bmo-mir-2774a-4
(2 sentences)

Stem-loop
   aca  a   uuc    c   gg           aua 
5'    ac aca   ggac guc  ucuaccgagca   u
      || |||   |||| |||  |||||||||||    
3'    ug ugu   ccug uag  agguggcucgu   u
   aua  c   uuc    c   -a           cca 
Get sequence
Deep sequencing
1036 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581683.1: 2996498-2996570 [+]
intergenic
Database links

Mature sequence bmo-miR-2774a

Accession MIMAT0013658
Sequence

44 - 

cucgguggaagaucgucccu

 - 63

Get sequence
Deep sequencing3097 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).