Stem-loop sequence bmo-mir-2774a-2

AccessionMI0012347 (change log)
DescriptionBombyx mori miR-2774a-2 stem-loop
Gene family MIPF0000829; mir-2774
Literature search

1 open access papers mention bmo-mir-2774a-2
(2 sentences)

Stem-loop
   acaaca   uuc    c   gg          aaua 
5'       aca   ggac guc  ucuaccgagc    u
         |||   |||| |||  ||||||||||     
3'       ugu   ccug uag  agguggcucg    c
   uauuac   uuc    c   -a          ccca 
Get sequence
Deep sequencing
1054 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581960.1: 1970-2042 [+]
intergenic
Database links

Mature sequence bmo-miR-2774a

Accession MIMAT0013658
Sequence

44 - 

cucgguggaagaucgucccu

 - 63

Get sequence
Deep sequencing3097 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).