Stem-loop sequence bmo-mir-2799

AccessionMI0012375 (change log)
DescriptionBombyx mori miR-2799 stem-loop
Literature search

1 open access papers mention bmo-mir-2799
(2 sentences)

Stem-loop
   aua                              uu 
5'    uggaauuagagguuuaugaacaugaugagu  a
      ||||||||||||||||||||||||||||||  c
3'    accuuaaucuccaaauacuuguacuacuca  g
   caa                              ua 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004581698.1: 1983814-1983886 [+]
intergenic
Database links

Mature sequence bmo-miR-2799

Accession MIMAT0013703
Sequence

11 - 

agagguuuaugaacaugaugag

 - 32

Get sequence
Deep sequencing65 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).