Stem-loop sequence bmo-mir-2808a-1

AccessionMI0012388 (change log)
DescriptionBombyx mori miR-2808a-1 stem-loop
Gene family MIPF0000836; mir-2808
Literature search

1 open access papers mention bmo-mir-2808a-1
(1 sentences)

Stem-loop
   -    g    -------    a a    a -  uc      ga 
5'  agcc ugcu       ucgu g aucu c ca  ggaucg  a
    |||| ||||       |||| | |||| | ||  ||||||   
3'  ucgg guga       agcg c uaga g gu  ccuagc  a
   g    -    cucaaag    g c    a a  ca      gc 
Get sequence
Deep sequencing
891 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582008.1: 2091354-2091431 [-]
intergenic
Database links

Mature sequence bmo-miR-2808a-5p

Accession MIMAT0013711
Previous IDsbmo-miR-2808a
Sequence

11 - 

cguagaaucuaccaucggaucg

 - 32

Get sequence
Deep sequencing232 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).