Stem-loop sequence bmo-mir-2808b

AccessionMI0012423 (change log)
DescriptionBombyx mori miR-2808b stem-loop
Gene family MIPF0000836; mir-2808
Literature search

1 open access papers mention bmo-mir-2808b
(1 sentences)

Stem-loop
   cuuuu       cua      c   uaa   -   cu   u 
5'      uuuuugg   ccgaug ugg   ucu cgg  agu a
        |||||||   |||||| |||   ||| |||  |||  
3'      aaagacu   ggcuac auc   aga gcu  ucg g
   cgcgc       --a      c   -ua   u   --   u 
Get sequence
Deep sequencing
104 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582034.1: 1389955-1390032 [+]
intergenic
Database links

Mature sequence bmo-miR-2808b

Accession MIMAT0013739
Sequence

48 - 

cguagaaucuaccaucggauc

 - 68

Get sequence
Deep sequencing100 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).