![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence rno-mir-1224 |
|||||
Accession | MI0012589 (change log) | ||||
Description | Rattus norvegicus miR-1224 stem-loop | ||||
Gene family | MIPF0000440; mir-1224 | ||||
Literature search |
![]()
6 open access papers mention rno-mir-1224 | ||||
Stem-loop |
g cu ------ u accau c 5' ugagga ggggaggugg aggg agu uagagc a |||||| |||||||||| |||| ||| |||||| 3' acuccu cuucuccacc uccc ucg gucucg g g cu ccccuc - acucu a |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: high
| ||||
Genome context |
|
||||
Database links |
Mature sequence rno-miR-1224 |
|
Accession | MIMAT0012827 |
Sequence |
1 - gugaggacuggggagguggag - 21 |
Deep sequencing | 17020 reads, 244 experiments |
Evidence | experimental; SOLiD [2] |
Predicted targets |
|
References |
|
1 |
PMID:18215311
"miRNAminer: a tool for homologous microRNA gene search"
BMC Bioinformatics. 9:39(2008).
|
2 |
PMID:20403161
"Small RNA expression and strain specificity in the rat"
BMC Genomics. 11:249(2010).
|