Stem-loop sequence eca-mir-107b

AccessionMI0012643 (change log)
DescriptionEquus caballus miR-107b stem-loop
Gene family MIPF0000024; mir-103
Literature search

2 open access papers mention eca-mir-107b
(3 sentences)

Stem-loop 
   c   c      --c    u  u           c   u   a 
5'  ucu ugcuuu   agcu cu uacaguguugc uug ggc u
    ||| ||||||   |||| || ||||||||||| ||| ||| g
3'  aga acgaaa   ucgg ga auguuacgacg aac uug g
   -   c      cua    -  c           -   -   a
Get sequence
Deep sequencing
8032 reads, 400 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr1: 38749365-38749445 [+]
sense
ENSECAT00000008322 ; PANK1-201; intron 7
Database links

Mature sequence eca-miR-107b

Accession MIMAT0012886
Sequence

50 -  

agcagcauuguacagggcuauca

 - 72

Get sequence
Deep sequencing8025 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).