Stem-loop sequence eca-mir-136

AccessionMI0012878 (change log)
DescriptionEquus caballus miR-136 stem-loop
Gene family MIPF0000099; mir-136
Stem-loop
           c     uuu          uuc 
5' gaggacuc auuug   ugaugaugga   u
   |||||||| |||||   ||||||||||   u
3' cuucugag uaaac   gcuacuaccu   a
           -     ucu          cgc 
Get sequence
Deep sequencing
9600 reads, 550 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42748685-42748746 [+]
sense
ENSECAT00000028133 ; eca-mir-136-201; exon 1
Clustered miRNAs
< 10kb from eca-mir-136
eca-mir-337chr24: 42738909-42739000 [+]
eca-mir-431chr24: 42745020-42745108 [+]
eca-mir-433chr24: 42745895-42746018 [+]
eca-mir-127chr24: 42747005-42747074 [+]
eca-mir-432chr24: 42748485-42748573 [+]
eca-mir-136chr24: 42748685-42748746 [+]
Database links

Mature sequence eca-miR-136

Accession MIMAT0013128
Sequence

5 - 

acuccauuuguuuugaugaugg

 - 26

Get sequence
Deep sequencing2809 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).