Stem-loop sequence eca-mir-432

AccessionMI0012901 (change log)
DescriptionEquus caballus miR-432 stem-loop
Gene family MIPF0000211; mir-432
Stem-loop
   ugcgugacuccu     u u     ua       g     a   uu   uu 
5'             ccagg c uggag  ggucauu ggugg ucc  uau  c
               ||||| | |||||  ||||||| ||||| |||  |||   
3'             gguuc g accuc  ucgguag ucacc ggg  gua  c
   ------------     u u     -c       g     -   -u   uc 
Get sequence
Deep sequencing
2173 reads, 100 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chr24: 42748485-42748573 [+]
intergenic
Clustered miRNAs
< 10kb from eca-mir-432
eca-mir-337chr24: 42738909-42739000 [+]
eca-mir-431chr24: 42745020-42745108 [+]
eca-mir-433chr24: 42745895-42746018 [+]
eca-mir-127chr24: 42747005-42747074 [+]
eca-mir-432chr24: 42748485-42748573 [+]
eca-mir-136chr24: 42748685-42748746 [+]
Database links

Mature sequence eca-miR-432

Accession MIMAT0013157
Sequence

18 - 

ucuuggaguaggucauugggugg

 - 40

Get sequence
Deep sequencing2166 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).