Stem-loop sequence eca-mir-542

AccessionMI0012980 (change log)
DescriptionEquus caballus miR-542 stem-loop
Gene family MIPF0000185; mir-542
Literature search

1 open access papers mention eca-mir-542
(1 sentences)

Stem-loop
   a  ac       auc    gg    uca         -a   c 
5'  gg  cucagac   ucgg  auca   ugucacgag  uac a
    ||  |||||||   ||||  ||||   |||||||||  |||  
3'  cc  gggucug   aguc  uagu   acaguguuc  gug c
   -  ga       gaa    aa    uag         ac   u 
Get sequence
Deep sequencing
2482 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (EquCab2.0; GCF_000002305.2) Overlapping transcripts
chrX: 106949741-106949826 [-]
intergenic
Clustered miRNAs
< 10kb from eca-mir-542
eca-mir-424chrX: 106954949-106955046 [-]
eca-mir-503chrX: 106954617-106954687 [-]
eca-mir-542chrX: 106949741-106949826 [-]
eca-mir-450cchrX: 106948953-106949041 [-]
eca-mir-450achrX: 106948818-106948908 [-]
eca-mir-450bchrX: 106948655-106948733 [-]
Database links

Mature sequence eca-miR-542-5p

Accession MIMAT0013237
Sequence

15 - 

cucggggaucaucaugucacga

 - 36

Get sequence
Deep sequencing202 reads, 1 experiments
Evidence not experimental

Mature sequence eca-miR-542-3p

Accession MIMAT0013238
Sequence

53 - 

ugugacagauugauaacugaaa

 - 74

Get sequence
Deep sequencing2280 reads, 1 experiments
Evidence not experimental

References

1
PMID:19406225 "In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach" Zhou M, Wang Q, Sun J, Li X, Xu L, Yang H, Shi H, Ning S, Chen L, Li Y, He T, Zheng Y Genomics. 94:125-131(2009).