Stem-loop sequence bmo-mir-2856-1

AccessionMI0012998 (change log)
DescriptionBombyx mori miR-2856-1 stem-loop
Gene family MIPF0001071; mir-2856
Literature search

1 open access papers mention bmo-mir-2856-1
(1 sentences)

Stem-loop
   ac    c  uc      -gu     ga     ag   g  acag 
5'   ugua ua  uugucu   gguuc  gggug  auu uc    c
     |||| ||  ||||||   |||||  |||||  ||| ||    a
3'   auau au  aacaga   ccaag  cuuac  ugg gg    g
   aa    a  -u      aug     ag     -a   g  auau 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM15162v1; GCA_000151625.1) Overlapping transcripts
NW_004582014.1: 3494478-3494565 [+]
intergenic
Database links

Mature sequence bmo-miR-2856-5p

Accession MIMAT0013792
Previous IDsbmo-miR-2856*
Sequence

12 - 

uugucugugguucgagggug

 - 31

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence bmo-miR-2856-3p

Accession MIMAT0013793
Previous IDsbmo-miR-2856
Sequence

57 - 

acauucgagaaccguaagacaa

 - 78

Get sequence
Deep sequencing106 reads, 3 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:20199675 "MicroRNAs of Bombyx mori identified by Solexa sequencing" Liu S, Li D, Li Q, Zhao P, Xiang Z, Xia Q BMC Genomics. 11:148(2010).