Stem-loop sequence api-mir-190

AccessionMI0013353 (change log)
DescriptionAcyrthosiphon pisum miR-190 stem-loop
Gene family MIPF0000076; mir-190
Literature search

1 open access papers mention api-mir-190
(1 sentences)

Stem-loop
   uuc                au         uuaua 
5'    gugagauauguuugau  ucuugguug     u
      ||||||||||||||||  |||||||||     u
3'    cauuuuauacaggcua  agagccagc     u
   ---                --         caaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350285.1: 84177-84244 [-]
intergenic
Database links

Mature sequence api-miR-190

Accession MIMAT0014127
Sequence

7 - 

agauauguuugauauucuugguug

 - 30

Get sequence
Evidence experimental; Illumina [2]

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).
2
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).