Stem-loop sequence api-bantam

AccessionMI0013356 (change log)
DescriptionAcyrthosiphon pisum bantam stem-loop
Gene family MIPF0000153; bantam
Stem-loop
   cgaagc          uu     ug     uuuauc 
5'       ugguuuucac  ugauc  ucaga      a
         ||||||||||  |||||  |||||      u
3'       aucgaaagug  acuag  agucu      u
   --uuua          uu     --     uacuug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349821.1: 48793-48863 [+]
intergenic
Database links

Mature sequence api-bantam

Accession MIMAT0014130
Sequence

48 - 

ugagaucauugugaaagcuaauu

 - 70

Get sequence
Evidence experimental; Illumina [2]

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).
2
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).