Stem-loop sequence api-mir-184a

AccessionMI0013358 (change log)
Previous IDsapi-mir-184
DescriptionAcyrthosiphon pisum miR-184a stem-loop
Gene family MIPF0000059; mir-184
Literature search

1 open access papers mention api-mir-184a
(1 sentences)

Stem-loop
   --------        -       -  uug   gca 
5'         ccuuauca uucuucg cc   ugu   a
           |||||||| ||||||| ||   |||   u
3'         ggaauagu aagaggc gg   aca   u
   uauggucg        c       a  uca   aau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL350713.1: 96305-96369 [+]
intergenic
Database links

Mature sequence api-miR-184a

Accession MIMAT0014132
Previous IDsapi-miR-184
Sequence

38 - 

uggacggagaacugauaagggc

 - 59

Get sequence
Evidence experimental; Illumina [2]

References

1
"Computational Identification of MicroRNA Homologs from Acyrthosiphon pisum (Pea Aphid)" Sathyamurthy G, Swamy NR J. Comp. Intell. Bioinf. 2:109-119(2009).
2
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).