Stem-loop sequence rco-MIR156a

AccessionMI0013370 (change log)
DescriptionRicinus communis miR156a stem-loop
Gene family MIPF0000008; MIR156
Literature search

2 open access papers mention rco-MIR156a
(12 sentences)

Stem-loop
   ----    gu      -    a           u    uucuu    aucg 
5'     gggc  gacaga agag gugagcacaca gguu     gcau    a
       ||||  |||||| |||| ||||||||||| ||||     ||||    u
3'     cccg  cugucu ucuc cacucgugugu ucga     cgua    a
   ucca    --      a    c           c    -uuuu    guuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973784.1: 261490-261586 [-]
intergenic
Database links

Mature sequence rco-miR156a

Accession MIMAT0014144
Sequence

6 - 

ugacagaagagagugagcaca

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).