Stem-loop sequence rco-MIR156b

AccessionMI0013371 (change log)
DescriptionRicinus communis miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

2 open access papers mention rco-MIR156b
(10 sentences)

Stem-loop
   -   -a         -    -        a        uuu     a 
5'  gaa  uugacagaa gaga gugagcac cagaggca   guaua a
    |||  ||||||||| |||| |||||||| ||||||||   |||||  
3'  cuu  aacugucuu cucu cacucgug guuuucgu   cauau u
   c   cg         u    u        c        ucc     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973791.1: 572263-572354 [-]
intergenic
Database links

Mature sequence rco-miR156b

Accession MIMAT0014145
Sequence

6 - 

ugacagaagagagugagcaca

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).