Stem-loop sequence rco-MIR156d

AccessionMI0013373 (change log)
DescriptionRicinus communis miR156d stem-loop
Gene family MIPF0000008; MIR156
Literature search

2 open access papers mention rco-MIR156d
(10 sentences)

Stem-loop
   --  ga         -     -       a   ag   auu        
5'   ga  cugacagaa gagag ugagcac cgc  gca   guaugga 
     ||  ||||||||| ||||| ||||||| |||  |||   |||||| a
3'   cu  gacugucuu cucuc acucgug gug  cgu   cauaccg 
   ac  uc         u     c       c   ga   cac        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974930.1: 20214-20306 [-]
intergenic
Database links

Mature sequence rco-miR156d

Accession MIMAT0014147
Sequence

6 - 

ugacagaagagagugagcaca

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).