Stem-loop sequence rco-MIR156e

AccessionMI0013374 (change log)
DescriptionRicinus communis miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

2 open access papers mention rco-MIR156e
(10 sentences)

Stem-loop
   --a   u           -          -a       uu    u      
5'    aug ugacagaagag agagagcaca  cccggca  aggc aaaga 
      ||| ||||||||||| ||||||||||  |||||||  |||| |||| g
3'    uac acugucuucuc ucucucgugu  ggguugu  uccg uuucu 
   cac   u           c          ga       -u    -      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973899.1: 52393-52487 [+]
intergenic
Database links

Mature sequence rco-miR156e

Accession MIMAT0014148
Sequence

6 - 

ugacagaagagagagagcaca

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).