Stem-loop sequence rco-MIR156f

AccessionMI0013375 (change log)
DescriptionRicinus communis miR156f stem-loop
Gene family MIPF0000008; MIR156
Literature search

2 open access papers mention rco-MIR156f
(11 sentences)

Stem-loop
   --uuuu            -u          --    a      c   cga 
5'       guugacagaaga  agagagcaca  acuu acauac caa   c
         ||||||||||||  ||||||||||  |||| |||||| |||    
3'       caacugucuucu  uuucucgugu  ugaa uguaug guu   a
   uauauu            uu          uu    g      u   uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974021.1: 163473-163569 [-]
intergenic
Database links

Mature sequence rco-miR156f

Accession MIMAT0014149
Sequence

6 - 

uugacagaagauagagagcac

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).