Stem-loop sequence rco-MIR156g

AccessionMI0013376 (change log)
DescriptionRicinus communis miR156g stem-loop
Gene family MIPF0000008; MIR156
Literature search

2 open access papers mention rco-MIR156g
(10 sentences)

Stem-loop
   --  u  u           -         u  c  -   a     u  ug 
5'   ug ug ugacagaagau agagagcac ga ga uga augca ga  g
     || || ||||||||||| ||||||||| || || ||| ||||| ||   
3'   ac ac acugucuucug ucucucgug uu cu acu uacgu cu  g
   cc  u  u           a         u  c  c   c     -  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974075.1: 129746-129842 [-]
intergenic
Database links

Mature sequence rco-miR156g

Accession MIMAT0014150
Sequence

6 - 

uugacagaagauagagagcac

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).