Stem-loop sequence rco-MIR156h

AccessionMI0013377 (change log)
DescriptionRicinus communis miR156h stem-loop
Gene family MIPF0000008; MIR156
Literature search

2 open access papers mention rco-MIR156h
(10 sentences)

Stem-loop
   --ugu  u         -              u  -   u     auga 
5'      ug ugacagaag auagagagcacaga ga uga gugca    c
        || ||||||||| |||||||||||||| || ||| |||||    u
3'      ac acugucuuc uaucucucguguuu cu acu uacgu    u
   cuucc  u         g              c  c   c     cuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973947.1: 225693-225789 [-]
intergenic
Database links

Mature sequence rco-miR156h

Accession MIMAT0014151
Sequence

6 - 

uugacagaagauagagagcac

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).