Stem-loop sequence rco-MIR160a

AccessionMI0013379 (change log)
DescriptionRicinus communis miR160a stem-loop
Gene family MIPF0000032; MIR160
Literature search

2 open access papers mention rco-MIR160a
(4 sentences)

Stem-loop
   --uu      c       c               a  uu      a 
5'     gugugc uggcucc uguaugccauuugug ag  caucag a
       |||||| ||||||| ||||||||||||||| ||  ||||||  
3'     cguacg accgagg acguacgguagacgc uc  gugguu g
   ucgu      u       a               c  ug      c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973837.1: 860029-860120 [+]
intergenic
Database links

Mature sequence rco-miR160a

Accession MIMAT0014153
Sequence

6 - 

ugccuggcucccuguaugcca

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).