Stem-loop sequence rco-MIR160b

AccessionMI0013380 (change log)
DescriptionRicinus communis miR160b stem-loop
Gene family MIPF0000032; MIR160
Literature search

2 open access papers mention rco-MIR160b
(4 sentences)

Stem-loop
   -- gu     c       c          aa  uag   u  u   cu 
5'   g  uaugc uggcucc uguaugccac  gc   agu ca ucc  u
     |  ||||| ||||||| ||||||||||  ||   ||| || |||  c
3'   c  auacg accgagg gcgugcggug  cg   ucg gu agg  c
   cu uc     a       a          gc  uua   -  u   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ977159.1: 1207-1302 [+]
intergenic
Database links

Mature sequence rco-miR160b

Accession MIMAT0014154
Sequence

6 - 

ugccuggcucccuguaugcca

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).