Stem-loop sequence rco-MIR162

AccessionMI0013381 (change log)
DescriptionRicinus communis miR162 stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

1 open access papers mention rco-MIR162
(2 sentences)

Stem-loop
   --uca     g    c    c       ucuuccuggaagauuuuguugu 
5'      cugga gcag gguu aucgauc                      g
        ||||| |||| |||| |||||||                      a
3'      gaccu cguc ccaa uagcuag                      a
   uucgc     a    u    a       cuaaguacgcaaaauaaaaaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973775.1: 2654842-2654942 [+]
intergenic
Database links

Mature sequence rco-miR162

Accession MIMAT0014155
Sequence

76 - 

ucgauaaaccucugcauccag

 - 96

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).