Stem-loop sequence rco-MIR164b

AccessionMI0013383 (change log)
DescriptionRicinus communis miR164b stem-loop
Gene family MIPF0000045; MIR164
Literature search

2 open access papers mention rco-MIR164b
(2 sentences)

Stem-loop
   -  -  c        ca             --ccccaacac   -     uuc 
5'  cc ug uggagaag  gggcacgugcaaa           ucc uuggu   u
    || || ||||||||  |||||||||||||           ||| |||||   u
3'  gg ac accucuuc  cucgugcacguuu           agg aaccg   g
   u  u  a        cc             ucucauaucaa   u     uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973909.1: 260730-260833 [-]
intergenic
Database links

Mature sequence rco-miR164b

Accession MIMAT0014157
Sequence

6 - 

uggagaagcagggcacgugca

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).