Stem-loop sequence rco-MIR164d

AccessionMI0013385 (change log)
DescriptionRicinus communis miR164d stem-loop
Gene family MIPF0000045; MIR164
Literature search

2 open access papers mention rco-MIR164d
(2 sentences)

Stem-loop
   --  u         gc           u      a    aa g 
5'   ca gcuggagaa  agggcacaugc agauuu ucag  u a
     || |||||||||  ||||||||||| |||||| ||||  |  
3'   gu cgaccucuu  uuccguguacg uuuaag aguc  a a
   ag  u         gu           u      -    ca a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974122.1: 135552-135636 [-]
intergenic
Database links

Mature sequence rco-miR164d

Accession MIMAT0014159
Sequence

6 - 

uggagaagcagggcacaugcu

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).