Stem-loop sequence rco-MIR166a

AccessionMI0013386 (change log)
DescriptionRicinus communis miR166a stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention rco-MIR166a
(5 sentences)

Stem-loop
   --           uu         a   ccua    ----u     uguuucaguuucauucaauauacugaaaaa 
5'   uaaggggaaug  gucugguuc agg    ccua     ugauc                              u
     |||||||||||  ||||||||| |||    ||||     |||||                              c
3'   auuccccuuac  cggaccagg ucc    ggau     acuag                              u
   ua           uu         c   ucua    ucuuu     uuuagcugguguccuaucaaaggguauaug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973793.1: 790389-790537 [-]
intergenic
Database links

Mature sequence rco-miR166a

Accession MIMAT0014160
Sequence

124 - 

ucggaccaggcuucauucccc

 - 144

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).