Stem-loop sequence rco-MIR166b

AccessionMI0013387 (change log)
DescriptionRicinus communis miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention rco-MIR166b
(5 sentences)

Stem-loop
   --  a        uu      cu   g         ---ua    u       u     ug 
5'   ug ggggaaug  gucugg  cga gucacuaau     gauc augauuu auuuu  c
     || ||||||||  ||||||  ||| |||||||||     |||| ||||||| |||||  u
3'   ac ccccuuac  cggacc  gcu cagugauug     cuag ugcuaga uagaa  u
   ua  c        uu      ag   g         uuaug    u       -     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973832.1: 399591-399709 [+]
intergenic
Database links

Mature sequence rco-miR166b

Accession MIMAT0014161
Sequence

94 - 

ucggaccaggcuucauucccc

 - 114

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).