Stem-loop sequence rco-MIR166c

AccessionMI0013388 (change log)
DescriptionRicinus communis miR166c stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention rco-MIR166c
(5 sentences)

Stem-loop
   --  a  u     uu           u        u  u   aag 
5'   ug gg gaaug  gucugguucga gucauuca uu gug   c
     || || |||||  ||||||||||| |||||||| || |||   u
3'   ac cc cuuac  cggaccaggcu uaguaagu aa uac   g
   ca  c  c     uu           u        c  u   aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973866.1: 487103-487193 [-]
intergenic
Database links

Mature sequence rco-miR166c

Accession MIMAT0014162
Sequence

66 - 

ucggaccaggcuucauucccc

 - 86

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).